Review



dominant negative rab7  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Addgene inc dominant negative rab7
    ( A and B ) Affibody-chase experiments. Cells surface labeled with FITC-conjugated HER2 affibody and stimulated with soluble LAP (LAP) to stimulate α V β 6 integrin and trigger α V β 6 endocytosis, or vehicle (Control), 0- to 60-min time course. Quantitation represents cytoplasmic HER2 fluorescence intensity analysis in (A) trastuzumab-sensitive or (B) trastuzumab-resistant BT474 cells ( N = 3; 27 to 50 cells per condition), normalized to control trastuzumab-sensitive BT474 cells (0 min); scale bar, 10 μm. Two-way ANOVA with Šídák’s multiple comparison test. Image intensity increased in (B), relative to (A), due to low cell surface HER2 levels in trastuzumab-resistant cells to highlight internalization differences. ( C ) HER2 (green) and RAB5 (magenta) immunofluorescence in trastuzumab-sensitive and trastuzumab-resistant BT474 cells, treated with soluble LAP, 0 to 60 min ( N = 3; 16 to 28 cells per condition); scale bar, 10 μm. ( Ca ) HER2/RAB5 colocalization quantitation (Pearson’s coefficient ± SEM). Two-way ANOVA with Dunnett’s multiple comparison test. ( D ) Active RAB5 pull-down assays. 0- to 60-min LAP stimulation time course. Quantitation of mean RAB5 activity (pull-down eluate), relative to total RAB5 (lysate) ± SEM ( N = 3), normalized to 0-min trastuzumab-sensitive cells. One-way ANOVA with Dunnett’s multiple comparison test. ( E and F ) Affibody-chase experiments in (E) siControl Trastuzumab-Sensitive or (F) Trastuzumab-Resistant BT474 cells expressing constitutively active RAB5 (RAB5CA), dominant-negative RAB5 (RAB5DN), dominant-negative <t>RAB7</t> (RAB7DN), or mCherry vector control. Cells were surface labeled with FITC-conjugated HER2 affibody and stimulated with soluble LAP (LAP), or vehicle control (control), for 0 or 30 min. Quantitation represents cytoplasmic HER2 fluorescence intensity ( N = 3; 81 to 87 cells per condition); scale bar, 10 μm. One-way ANOVA with Tukey’s multiple comparison test. Representative images in fig. S10 (A and B). Further HER2 internalization analyses: Supplementary Results and fig. S11 (A to D). [(A), (B), and (D) to (F)] Data are arbitrary units (AU) normalized to control means ± SEM. [(A) to (F)] Statistical significance: * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.
    Dominant Negative Rab7, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 19 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dsred+rab7/DsRed-rab7+DN+(Plasmid+%2312662)/pmc11616693-376-26-30
    Average 93 stars, based on 19 article reviews
    dominant negative rab7 - by Bioz Stars, 2026-09
    93/100 stars

    Images

    1) Product Images from "A trafficking regulatory subnetwork governs α V β 6 integrin-HER2 cross-talk to control breast cancer invasion and drug resistance"

    Article Title: A trafficking regulatory subnetwork governs α V β 6 integrin-HER2 cross-talk to control breast cancer invasion and drug resistance

    Journal: Science Advances

    doi: 10.1126/sciadv.adk9944

    ( A and B ) Affibody-chase experiments. Cells surface labeled with FITC-conjugated HER2 affibody and stimulated with soluble LAP (LAP) to stimulate α V β 6 integrin and trigger α V β 6 endocytosis, or vehicle (Control), 0- to 60-min time course. Quantitation represents cytoplasmic HER2 fluorescence intensity analysis in (A) trastuzumab-sensitive or (B) trastuzumab-resistant BT474 cells ( N = 3; 27 to 50 cells per condition), normalized to control trastuzumab-sensitive BT474 cells (0 min); scale bar, 10 μm. Two-way ANOVA with Šídák’s multiple comparison test. Image intensity increased in (B), relative to (A), due to low cell surface HER2 levels in trastuzumab-resistant cells to highlight internalization differences. ( C ) HER2 (green) and RAB5 (magenta) immunofluorescence in trastuzumab-sensitive and trastuzumab-resistant BT474 cells, treated with soluble LAP, 0 to 60 min ( N = 3; 16 to 28 cells per condition); scale bar, 10 μm. ( Ca ) HER2/RAB5 colocalization quantitation (Pearson’s coefficient ± SEM). Two-way ANOVA with Dunnett’s multiple comparison test. ( D ) Active RAB5 pull-down assays. 0- to 60-min LAP stimulation time course. Quantitation of mean RAB5 activity (pull-down eluate), relative to total RAB5 (lysate) ± SEM ( N = 3), normalized to 0-min trastuzumab-sensitive cells. One-way ANOVA with Dunnett’s multiple comparison test. ( E and F ) Affibody-chase experiments in (E) siControl Trastuzumab-Sensitive or (F) Trastuzumab-Resistant BT474 cells expressing constitutively active RAB5 (RAB5CA), dominant-negative RAB5 (RAB5DN), dominant-negative RAB7 (RAB7DN), or mCherry vector control. Cells were surface labeled with FITC-conjugated HER2 affibody and stimulated with soluble LAP (LAP), or vehicle control (control), for 0 or 30 min. Quantitation represents cytoplasmic HER2 fluorescence intensity ( N = 3; 81 to 87 cells per condition); scale bar, 10 μm. One-way ANOVA with Tukey’s multiple comparison test. Representative images in fig. S10 (A and B). Further HER2 internalization analyses: Supplementary Results and fig. S11 (A to D). [(A), (B), and (D) to (F)] Data are arbitrary units (AU) normalized to control means ± SEM. [(A) to (F)] Statistical significance: * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.
    Figure Legend Snippet: ( A and B ) Affibody-chase experiments. Cells surface labeled with FITC-conjugated HER2 affibody and stimulated with soluble LAP (LAP) to stimulate α V β 6 integrin and trigger α V β 6 endocytosis, or vehicle (Control), 0- to 60-min time course. Quantitation represents cytoplasmic HER2 fluorescence intensity analysis in (A) trastuzumab-sensitive or (B) trastuzumab-resistant BT474 cells ( N = 3; 27 to 50 cells per condition), normalized to control trastuzumab-sensitive BT474 cells (0 min); scale bar, 10 μm. Two-way ANOVA with Šídák’s multiple comparison test. Image intensity increased in (B), relative to (A), due to low cell surface HER2 levels in trastuzumab-resistant cells to highlight internalization differences. ( C ) HER2 (green) and RAB5 (magenta) immunofluorescence in trastuzumab-sensitive and trastuzumab-resistant BT474 cells, treated with soluble LAP, 0 to 60 min ( N = 3; 16 to 28 cells per condition); scale bar, 10 μm. ( Ca ) HER2/RAB5 colocalization quantitation (Pearson’s coefficient ± SEM). Two-way ANOVA with Dunnett’s multiple comparison test. ( D ) Active RAB5 pull-down assays. 0- to 60-min LAP stimulation time course. Quantitation of mean RAB5 activity (pull-down eluate), relative to total RAB5 (lysate) ± SEM ( N = 3), normalized to 0-min trastuzumab-sensitive cells. One-way ANOVA with Dunnett’s multiple comparison test. ( E and F ) Affibody-chase experiments in (E) siControl Trastuzumab-Sensitive or (F) Trastuzumab-Resistant BT474 cells expressing constitutively active RAB5 (RAB5CA), dominant-negative RAB5 (RAB5DN), dominant-negative RAB7 (RAB7DN), or mCherry vector control. Cells were surface labeled with FITC-conjugated HER2 affibody and stimulated with soluble LAP (LAP), or vehicle control (control), for 0 or 30 min. Quantitation represents cytoplasmic HER2 fluorescence intensity ( N = 3; 81 to 87 cells per condition); scale bar, 10 μm. One-way ANOVA with Tukey’s multiple comparison test. Representative images in fig. S10 (A and B). Further HER2 internalization analyses: Supplementary Results and fig. S11 (A to D). [(A), (B), and (D) to (F)] Data are arbitrary units (AU) normalized to control means ± SEM. [(A) to (F)] Statistical significance: * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.

    Techniques Used: Labeling, Control, Quantitation Assay, Fluorescence, Comparison, Immunofluorescence, Activity Assay, Expressing, Dominant Negative Mutation, Plasmid Preparation

    ( A ) Trastuzumab-Sensitive Cells: GDI2 is recruited to sites proximal to α V β 6 IACs and coordinates HER2 and α V β 6 trafficking and signaling by locally modulating RAB5 activity. GDI2-mediated cross-talk between α V β 6 and HER2 affects membrane availability of both receptors, ultimately influencing migration, invasion, and TGFβ activation. ( B ) Trastuzumab-Resistant Cells: GDI2 is excluded from α V β 6 IACs, leading to dysregulation of RAB5 activation dynamics, followed by increased RAB7 activation. Consequently, HER2/α V β 6 cross-talk is impaired, altering receptor trafficking dynamics and disrupting bioavailability of both HER2 and α V β 6 integrin at the plasma membrane. This dysregulation further affects TGFβ activation, resulting in increased cell invasiveness and metastatic potential. Overall, these changes may increase the ability of cells to evade HER2 targeting drugs.
    Figure Legend Snippet: ( A ) Trastuzumab-Sensitive Cells: GDI2 is recruited to sites proximal to α V β 6 IACs and coordinates HER2 and α V β 6 trafficking and signaling by locally modulating RAB5 activity. GDI2-mediated cross-talk between α V β 6 and HER2 affects membrane availability of both receptors, ultimately influencing migration, invasion, and TGFβ activation. ( B ) Trastuzumab-Resistant Cells: GDI2 is excluded from α V β 6 IACs, leading to dysregulation of RAB5 activation dynamics, followed by increased RAB7 activation. Consequently, HER2/α V β 6 cross-talk is impaired, altering receptor trafficking dynamics and disrupting bioavailability of both HER2 and α V β 6 integrin at the plasma membrane. This dysregulation further affects TGFβ activation, resulting in increased cell invasiveness and metastatic potential. Overall, these changes may increase the ability of cells to evade HER2 targeting drugs.

    Techniques Used: Activity Assay, Membrane, Migration, Activation Assay, Clinical Proteomics

    ( A ) Differential gene expression data (RNA-seq) for the GDI2 / RAB5A / RAB7A / ERBB2 / ITGB6 cluster in normal breast tissue ( n = 403; light gray) and breast invasive carcinoma ( n = 1097; dark gray). Data were extracted from the TNMplot database ( tnmplot.com ). Black lines in violin blots represent the median. Mann-Whitney test. ( B ) Volcano plot showing statistical analysis (ANOVA) of RNA-seq gene expression data of patients with HER2+ breast cancer from the METABRIC cohort expressing high (Right) and low (Left) levels of ITGB6 (Q1 versus Q4). Significant genes (dark gray); nonsignificant genes (light gray); relevant genes are highlighted in purple. ( C ) Visual representation of GO terms analysis (ClueGO, cellular compartment) of genes highly and significantly expressed in tumors expressing high levels of ITGB6 (Q4). Colors represent specific merged GO term groups, node size represents the level of significance of each GO term, and clustering and edge length represent functionally grouped networks based on kappa score. ( D ) OS of patients with HER2+ breast cancer and with high (above median) expression of ITGB6 , expressing high (red) or low (black) levels of GDI2 , ERBB2 , RAB5A , and RAB7A . ( E and F ) Differential ITGB6 gene expression (gene chip) in patients with HER2+ breast cancer subdivided according to therapeutic response to trastuzumab. (E) Initial pathological complete response (responder) versus residual disease after completing therapy (nonresponder) ( n = 77 patients). (F) RFS at 5 years (responder) versus samples relapsed before 5 years (nonresponder) ( n = 24 patients). Two-sided Student’s t test. [(A), (E), and (F)] Statistical significance: * P < 0.05; **** P < 0.0001.
    Figure Legend Snippet: ( A ) Differential gene expression data (RNA-seq) for the GDI2 / RAB5A / RAB7A / ERBB2 / ITGB6 cluster in normal breast tissue ( n = 403; light gray) and breast invasive carcinoma ( n = 1097; dark gray). Data were extracted from the TNMplot database ( tnmplot.com ). Black lines in violin blots represent the median. Mann-Whitney test. ( B ) Volcano plot showing statistical analysis (ANOVA) of RNA-seq gene expression data of patients with HER2+ breast cancer from the METABRIC cohort expressing high (Right) and low (Left) levels of ITGB6 (Q1 versus Q4). Significant genes (dark gray); nonsignificant genes (light gray); relevant genes are highlighted in purple. ( C ) Visual representation of GO terms analysis (ClueGO, cellular compartment) of genes highly and significantly expressed in tumors expressing high levels of ITGB6 (Q4). Colors represent specific merged GO term groups, node size represents the level of significance of each GO term, and clustering and edge length represent functionally grouped networks based on kappa score. ( D ) OS of patients with HER2+ breast cancer and with high (above median) expression of ITGB6 , expressing high (red) or low (black) levels of GDI2 , ERBB2 , RAB5A , and RAB7A . ( E and F ) Differential ITGB6 gene expression (gene chip) in patients with HER2+ breast cancer subdivided according to therapeutic response to trastuzumab. (E) Initial pathological complete response (responder) versus residual disease after completing therapy (nonresponder) ( n = 77 patients). (F) RFS at 5 years (responder) versus samples relapsed before 5 years (nonresponder) ( n = 24 patients). Two-sided Student’s t test. [(A), (E), and (F)] Statistical significance: * P < 0.05; **** P < 0.0001.

    Techniques Used: Gene Expression, RNA Sequencing, MANN-WHITNEY, Expressing, Clinical Proteomics

    Related Articles

    Marker:

    Article Title: Temporal and spatial expression of zebrafish mctp genes and evaluation of frameshift alleles of mctp2b.
    Article Snippet: This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record.. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article.. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

    Transfection:

    Article Title: Tumor Susceptibility Gene 101 facilitates rapamycin-induced autophagic flux in neuron cells.
    Article Snippet: .. Neuroblastoma SHSY5Y cells were be seeded into 6-well plates, then transfected with 1 ug GFPMAP1LC3 [49] or mRFP-mWasabi-MAP1LC3 [50] or DsRed-Rab7 (12661, Addgene) plasmid using 1 μl Lipofectamine 2000 (Invitrogen, 157386) for 24 h. To generate GFP-MAP1LC3 stable cell line, neuroblastoma SHSY5Y cells were further selected with 400− 800 μg G418. ..

    Plasmid Preparation:

    Article Title: Tumor Susceptibility Gene 101 facilitates rapamycin-induced autophagic flux in neuron cells.
    Article Snippet: .. Neuroblastoma SHSY5Y cells were be seeded into 6-well plates, then transfected with 1 ug GFPMAP1LC3 [49] or mRFP-mWasabi-MAP1LC3 [50] or DsRed-Rab7 (12661, Addgene) plasmid using 1 μl Lipofectamine 2000 (Invitrogen, 157386) for 24 h. To generate GFP-MAP1LC3 stable cell line, neuroblastoma SHSY5Y cells were further selected with 400− 800 μg G418. ..

    Article Title: COMMD5/HCaRG Hooks Endosomes on Cytoskeleton and Coordinates EGFR Trafficking.
    Article Snippet: For Co-IP, the entire coding region of human COMMD5 including its 30UTR was fused (primers used are listed in the Key Resources Table) in frame to GFP in peGFP-C1 (Clontech) through a blunt HindIII site and sequenced. .. All plasmids, antibodies, and staining used in this study are listed in the KEY RESSOURCES TABLES. mCherry-Rab5, mCherry-Actin and mCherry-tubulin were kindly provided by Dr Morag Park (McGill University) and GFP-Rab5 and GFP-Rab11 by Dr Nicole Leclerc (CRCHUM). mCherry-WASH1-N-18 (plasmid #55163) were a gift from Michael Davidson (Addgene), and dsRed-Rab7 (plasmid #12661) was a gift from Richard Pagano (Addgene). ..

    Article Title: GGA2 and RAB13 promote activity-dependent β1-integrin recycling.
    Article Snippet: .. Other constructs included RFP-RAB5 (described in (De Franceschi et al., 2016)), DsRed-RAB7 (Addgene plasmid #12661), GFP-RAB4 and GFP-RAB11 (described in (Arjonen et al., 2012)) and GFP-EEA1 (Addgene plasmid #42307). .. Reduced and heat-denatured protein extracts were separated by SDS-PAGE (4–20% Mini-4– 20% Mini-PROTEAN® TGXTM Gel, Bio-Rad, 456-1094) and then transferred onto 0.2 μm nitrocellulose membranes (Trans-Blot Turbo Transfer Pack; Bio-Rad, 170-4158).

    Stable Transfection:

    Article Title: Tumor Susceptibility Gene 101 facilitates rapamycin-induced autophagic flux in neuron cells.
    Article Snippet: .. Neuroblastoma SHSY5Y cells were be seeded into 6-well plates, then transfected with 1 ug GFPMAP1LC3 [49] or mRFP-mWasabi-MAP1LC3 [50] or DsRed-Rab7 (12661, Addgene) plasmid using 1 μl Lipofectamine 2000 (Invitrogen, 157386) for 24 h. To generate GFP-MAP1LC3 stable cell line, neuroblastoma SHSY5Y cells were further selected with 400− 800 μg G418. ..

    Staining:

    Article Title: COMMD5/HCaRG Hooks Endosomes on Cytoskeleton and Coordinates EGFR Trafficking.
    Article Snippet: For Co-IP, the entire coding region of human COMMD5 including its 30UTR was fused (primers used are listed in the Key Resources Table) in frame to GFP in peGFP-C1 (Clontech) through a blunt HindIII site and sequenced. .. All plasmids, antibodies, and staining used in this study are listed in the KEY RESSOURCES TABLES. mCherry-Rab5, mCherry-Actin and mCherry-tubulin were kindly provided by Dr Morag Park (McGill University) and GFP-Rab5 and GFP-Rab11 by Dr Nicole Leclerc (CRCHUM). mCherry-WASH1-N-18 (plasmid #55163) were a gift from Michael Davidson (Addgene), and dsRed-Rab7 (plasmid #12661) was a gift from Richard Pagano (Addgene). ..

    Construct:

    Article Title: GGA2 and RAB13 promote activity-dependent β1-integrin recycling.
    Article Snippet: .. Other constructs included RFP-RAB5 (described in (De Franceschi et al., 2016)), DsRed-RAB7 (Addgene plasmid #12661), GFP-RAB4 and GFP-RAB11 (described in (Arjonen et al., 2012)) and GFP-EEA1 (Addgene plasmid #42307). .. Reduced and heat-denatured protein extracts were separated by SDS-PAGE (4–20% Mini-4– 20% Mini-PROTEAN® TGXTM Gel, Bio-Rad, 456-1094) and then transferred onto 0.2 μm nitrocellulose membranes (Trans-Blot Turbo Transfer Pack; Bio-Rad, 170-4158).

    Expressing:

    Article Title: Redirecting Vesicular Transport to Improve Non-viral Delivery of Molecular Cargo
    Article Snippet: .. Plasmids and oligonucleotides The following expression plasmids were obtained from Addgene: tf-LC3, EGFP-LC3 (#11546), mRFP-LC3 (#21075), GFP-Rab5B (#61802), EGFP-Rab6A (#49469), GFP-Rab7 (#12605), dsRed-Rab7 (#12661), dsRed-Rab11 (12679), LAMP1-RFP (#1817), mCherry-LAMP1 (#45147), mCherry-Atg5 (#13095), mCherry-p62(#55132), EGFP-Vamp7 (#42316), pEGFP-N1, and plasmids for the Sleeping Beauty transposon system, pCMV(CAT)T7-SB100 (#34879) and pSBbiGP (#60511). .. Plasmids for CRISPR/Cas9-mediated editing of TRAC , including pAP368 (to express TRAC gRNA-1 and EGFP reporter gene), pAP369 (to express TRAC gRNA-2 and EGFP reporter gene), and pAP370 (to express SpCas9) were obtained from Dr. Charles Gersbach’s laboratory. sgRNAs targeting TRAC were purchased from IDT; the sgRNA sequences were: AGAGTCTCTCAGCTGGTACA (sgRNA-1) and TGTGCTAGACATGAGGTCTA (sgRNA-2).

    Article Title: Redirecting Vesicular Transport to Improve Non-viral Delivery of Molecular Cargo
    Article Snippet: .. The following expression plasmids were obtained from Addgene: tf-LC3, EGFP-LC3 (#11546), mRFP-LC3 (#21075), GFP-Rab5B (#61802), EGFP-Rab6A (#49469), GFP-Rab7 (#12605), dsRed-Rab7 (#12661), dsRed-Rab11 (12679), LAMP1-RFP (#1817), mCherry-LAMP1 (#45147), mCherry-Atg5 (#13095), mCherry-p62(#55132), EGFP-Vamp7 (#42316), pEGFP-N1, and plasmids for the Sleeping Beauty transposon system, pCMV(CAT)T7-SB100 (#34879) and pSBbiGP (#60511). .. Plasmids for CRISPR/Cas9-mediated editing of TRAC , including pAP368 (to express TRAC gRNA-1 and EGFP reporter gene), pAP369 (to express TRAC gRNA-2 and EGFP reporter gene), and pAP370 (to express SpCas9) were obtained from Dr. Charles Gersbach’s laboratory. sgRNAs targeting TRAC were purchased from IDT; the sgRNA sequences were: AGAGTCTCTCAGCTGGTACA (sgRNA-1) and TGTGCTAGACATGAGGTCTA (sgRNA-2).



    Similar Products

    dominant negative rab7  (Addgene inc)
    93
    Addgene inc dominant negative rab7
    ( A and B ) Affibody-chase experiments. Cells surface labeled with FITC-conjugated HER2 affibody and stimulated with soluble LAP (LAP) to stimulate α V β 6 integrin and trigger α V β 6 endocytosis, or vehicle (Control), 0- to 60-min time course. Quantitation represents cytoplasmic HER2 fluorescence intensity analysis in (A) trastuzumab-sensitive or (B) trastuzumab-resistant BT474 cells ( N = 3; 27 to 50 cells per condition), normalized to control trastuzumab-sensitive BT474 cells (0 min); scale bar, 10 μm. Two-way ANOVA with Šídák’s multiple comparison test. Image intensity increased in (B), relative to (A), due to low cell surface HER2 levels in trastuzumab-resistant cells to highlight internalization differences. ( C ) HER2 (green) and RAB5 (magenta) immunofluorescence in trastuzumab-sensitive and trastuzumab-resistant BT474 cells, treated with soluble LAP, 0 to 60 min ( N = 3; 16 to 28 cells per condition); scale bar, 10 μm. ( Ca ) HER2/RAB5 colocalization quantitation (Pearson’s coefficient ± SEM). Two-way ANOVA with Dunnett’s multiple comparison test. ( D ) Active RAB5 pull-down assays. 0- to 60-min LAP stimulation time course. Quantitation of mean RAB5 activity (pull-down eluate), relative to total RAB5 (lysate) ± SEM ( N = 3), normalized to 0-min trastuzumab-sensitive cells. One-way ANOVA with Dunnett’s multiple comparison test. ( E and F ) Affibody-chase experiments in (E) siControl Trastuzumab-Sensitive or (F) Trastuzumab-Resistant BT474 cells expressing constitutively active RAB5 (RAB5CA), dominant-negative RAB5 (RAB5DN), dominant-negative <t>RAB7</t> (RAB7DN), or mCherry vector control. Cells were surface labeled with FITC-conjugated HER2 affibody and stimulated with soluble LAP (LAP), or vehicle control (control), for 0 or 30 min. Quantitation represents cytoplasmic HER2 fluorescence intensity ( N = 3; 81 to 87 cells per condition); scale bar, 10 μm. One-way ANOVA with Tukey’s multiple comparison test. Representative images in fig. S10 (A and B). Further HER2 internalization analyses: Supplementary Results and fig. S11 (A to D). [(A), (B), and (D) to (F)] Data are arbitrary units (AU) normalized to control means ± SEM. [(A) to (F)] Statistical significance: * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.
    Dominant Negative Rab7, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dsred+rab7/DsRed-rab7+DN+(Plasmid+%2312662)/pmc11616693-376-26-30
    Average 93 stars, based on 1 article reviews
    dominant negative rab7 - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    addgene plasmid  (Addgene inc)
    93
    Addgene inc addgene plasmid
    ( A and B ) Affibody-chase experiments. Cells surface labeled with FITC-conjugated HER2 affibody and stimulated with soluble LAP (LAP) to stimulate α V β 6 integrin and trigger α V β 6 endocytosis, or vehicle (Control), 0- to 60-min time course. Quantitation represents cytoplasmic HER2 fluorescence intensity analysis in (A) trastuzumab-sensitive or (B) trastuzumab-resistant BT474 cells ( N = 3; 27 to 50 cells per condition), normalized to control trastuzumab-sensitive BT474 cells (0 min); scale bar, 10 μm. Two-way ANOVA with Šídák’s multiple comparison test. Image intensity increased in (B), relative to (A), due to low cell surface HER2 levels in trastuzumab-resistant cells to highlight internalization differences. ( C ) HER2 (green) and RAB5 (magenta) immunofluorescence in trastuzumab-sensitive and trastuzumab-resistant BT474 cells, treated with soluble LAP, 0 to 60 min ( N = 3; 16 to 28 cells per condition); scale bar, 10 μm. ( Ca ) HER2/RAB5 colocalization quantitation (Pearson’s coefficient ± SEM). Two-way ANOVA with Dunnett’s multiple comparison test. ( D ) Active RAB5 pull-down assays. 0- to 60-min LAP stimulation time course. Quantitation of mean RAB5 activity (pull-down eluate), relative to total RAB5 (lysate) ± SEM ( N = 3), normalized to 0-min trastuzumab-sensitive cells. One-way ANOVA with Dunnett’s multiple comparison test. ( E and F ) Affibody-chase experiments in (E) siControl Trastuzumab-Sensitive or (F) Trastuzumab-Resistant BT474 cells expressing constitutively active RAB5 (RAB5CA), dominant-negative RAB5 (RAB5DN), dominant-negative <t>RAB7</t> (RAB7DN), or mCherry vector control. Cells were surface labeled with FITC-conjugated HER2 affibody and stimulated with soluble LAP (LAP), or vehicle control (control), for 0 or 30 min. Quantitation represents cytoplasmic HER2 fluorescence intensity ( N = 3; 81 to 87 cells per condition); scale bar, 10 μm. One-way ANOVA with Tukey’s multiple comparison test. Representative images in fig. S10 (A and B). Further HER2 internalization analyses: Supplementary Results and fig. S11 (A to D). [(A), (B), and (D) to (F)] Data are arbitrary units (AU) normalized to control means ± SEM. [(A) to (F)] Statistical significance: * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.
    Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dsred+rab7/DsRed-rab7+DN+(Plasmid+%2312662)/pmc11616693-376-30-30
    Average 93 stars, based on 1 article reviews
    addgene plasmid - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    dsred rab7 dn  (Addgene inc)
    93
    Addgene inc dsred rab7 dn
    ( A ) HeLa cells transfected with GFP–RIG-I and TAPE-RFP were mock-treated or transfected with 5′-triphosphate RNA (5′ppp RNA; 1 μg/ml) for 4 hours. These cells were subjected to confocal microscopic analyses. Arrows indicated the merged speckles. ( B ) Similar to (A), FITC-labeled polyI:C (1 μg/ml) was transfected into HeLa cells expressing RIG-I–CFP and TAPE-RFP for 1.5 hours. The outlined area is enlarged to show merged speckles (right). ( C ) Confocal images of HeLa cells transfected with GFP–RIG-I and Rab5-RFP before and after polyI:C transfection for the indicated times (left). The outlined regions are magnified (middle). The fluorescent intensity of the white lines was measured in the areas (right). ( D ) Confocal images of HeLa cells transfected with GFP–RIG-I and <t>Rab7-RFP</t> before and after polyI:C transfection for the indicated times (left). The outlined regions are magnified (right). ( E ) Confocal images of HeLa cells transfected with GFP–RIG-I and FLAG-MAVS before and after polyI:C transfection for the indicated times (left). FLAG-MAVS was immunostained by the anti-FLAG antibody. ( F ) HEK293T cells were transfected with Flag–RIG-I alone or with RFP-Rab5 and then left untreated or treated with IAV RNA transfection for 3 hours. The IP-WB analysis examined RIG-I interaction with Rab5. ( G ) Confocal images of HeLa cells transfected with TAPE-CFP, GFP–RIG-I, and RFP-Rab5 before and after 5′ppp RNA (1 μg/ml) stimulation. Arrows denote speckles formed by TAPE-CFP, GFP–RIG-I, and RFP-Rab5. Scale bars, (A to E and G) 10 μm.
    Dsred Rab7 Dn, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dsred+rab7/DsRed-rab7+DN+(Plasmid+%2312662)/pmc11540011-235-8-10
    Average 93 stars, based on 1 article reviews
    dsred rab7 dn - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    dsred-rab7 (#12661)  (Addgene inc)
    90
    Addgene inc dsred-rab7 (#12661)
    ( A ) HeLa cells transfected with GFP–RIG-I and TAPE-RFP were mock-treated or transfected with 5′-triphosphate RNA (5′ppp RNA; 1 μg/ml) for 4 hours. These cells were subjected to confocal microscopic analyses. Arrows indicated the merged speckles. ( B ) Similar to (A), FITC-labeled polyI:C (1 μg/ml) was transfected into HeLa cells expressing RIG-I–CFP and TAPE-RFP for 1.5 hours. The outlined area is enlarged to show merged speckles (right). ( C ) Confocal images of HeLa cells transfected with GFP–RIG-I and Rab5-RFP before and after polyI:C transfection for the indicated times (left). The outlined regions are magnified (middle). The fluorescent intensity of the white lines was measured in the areas (right). ( D ) Confocal images of HeLa cells transfected with GFP–RIG-I and <t>Rab7-RFP</t> before and after polyI:C transfection for the indicated times (left). The outlined regions are magnified (right). ( E ) Confocal images of HeLa cells transfected with GFP–RIG-I and FLAG-MAVS before and after polyI:C transfection for the indicated times (left). FLAG-MAVS was immunostained by the anti-FLAG antibody. ( F ) HEK293T cells were transfected with Flag–RIG-I alone or with RFP-Rab5 and then left untreated or treated with IAV RNA transfection for 3 hours. The IP-WB analysis examined RIG-I interaction with Rab5. ( G ) Confocal images of HeLa cells transfected with TAPE-CFP, GFP–RIG-I, and RFP-Rab5 before and after 5′ppp RNA (1 μg/ml) stimulation. Arrows denote speckles formed by TAPE-CFP, GFP–RIG-I, and RFP-Rab5. Scale bars, (A to E and G) 10 μm.
    Dsred Rab7 (#12661), supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dsred+rab7/gfp+rab7/pm37252359-187-16-9
    Average 90 stars, based on 1 article reviews
    dsred-rab7 (#12661) - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    rab7  (Addgene inc)
    93
    Addgene inc rab7
    ( A ) HeLa cells transfected with GFP–RIG-I and TAPE-RFP were mock-treated or transfected with 5′-triphosphate RNA (5′ppp RNA; 1 μg/ml) for 4 hours. These cells were subjected to confocal microscopic analyses. Arrows indicated the merged speckles. ( B ) Similar to (A), FITC-labeled polyI:C (1 μg/ml) was transfected into HeLa cells expressing RIG-I–CFP and TAPE-RFP for 1.5 hours. The outlined area is enlarged to show merged speckles (right). ( C ) Confocal images of HeLa cells transfected with GFP–RIG-I and Rab5-RFP before and after polyI:C transfection for the indicated times (left). The outlined regions are magnified (middle). The fluorescent intensity of the white lines was measured in the areas (right). ( D ) Confocal images of HeLa cells transfected with GFP–RIG-I and <t>Rab7-RFP</t> before and after polyI:C transfection for the indicated times (left). The outlined regions are magnified (right). ( E ) Confocal images of HeLa cells transfected with GFP–RIG-I and FLAG-MAVS before and after polyI:C transfection for the indicated times (left). FLAG-MAVS was immunostained by the anti-FLAG antibody. ( F ) HEK293T cells were transfected with Flag–RIG-I alone or with RFP-Rab5 and then left untreated or treated with IAV RNA transfection for 3 hours. The IP-WB analysis examined RIG-I interaction with Rab5. ( G ) Confocal images of HeLa cells transfected with TAPE-CFP, GFP–RIG-I, and RFP-Rab5 before and after 5′ppp RNA (1 μg/ml) stimulation. Arrows denote speckles formed by TAPE-CFP, GFP–RIG-I, and RFP-Rab5. Scale bars, (A to E and G) 10 μm.
    Rab7, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dsred+rab7/DsRed-rab7+WT+(Plasmid+%2312661)/pmc10085862-124-0-22
    Average 93 stars, based on 1 article reviews
    rab7 - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier

    Image Search Results


    ( A and B ) Affibody-chase experiments. Cells surface labeled with FITC-conjugated HER2 affibody and stimulated with soluble LAP (LAP) to stimulate α V β 6 integrin and trigger α V β 6 endocytosis, or vehicle (Control), 0- to 60-min time course. Quantitation represents cytoplasmic HER2 fluorescence intensity analysis in (A) trastuzumab-sensitive or (B) trastuzumab-resistant BT474 cells ( N = 3; 27 to 50 cells per condition), normalized to control trastuzumab-sensitive BT474 cells (0 min); scale bar, 10 μm. Two-way ANOVA with Šídák’s multiple comparison test. Image intensity increased in (B), relative to (A), due to low cell surface HER2 levels in trastuzumab-resistant cells to highlight internalization differences. ( C ) HER2 (green) and RAB5 (magenta) immunofluorescence in trastuzumab-sensitive and trastuzumab-resistant BT474 cells, treated with soluble LAP, 0 to 60 min ( N = 3; 16 to 28 cells per condition); scale bar, 10 μm. ( Ca ) HER2/RAB5 colocalization quantitation (Pearson’s coefficient ± SEM). Two-way ANOVA with Dunnett’s multiple comparison test. ( D ) Active RAB5 pull-down assays. 0- to 60-min LAP stimulation time course. Quantitation of mean RAB5 activity (pull-down eluate), relative to total RAB5 (lysate) ± SEM ( N = 3), normalized to 0-min trastuzumab-sensitive cells. One-way ANOVA with Dunnett’s multiple comparison test. ( E and F ) Affibody-chase experiments in (E) siControl Trastuzumab-Sensitive or (F) Trastuzumab-Resistant BT474 cells expressing constitutively active RAB5 (RAB5CA), dominant-negative RAB5 (RAB5DN), dominant-negative RAB7 (RAB7DN), or mCherry vector control. Cells were surface labeled with FITC-conjugated HER2 affibody and stimulated with soluble LAP (LAP), or vehicle control (control), for 0 or 30 min. Quantitation represents cytoplasmic HER2 fluorescence intensity ( N = 3; 81 to 87 cells per condition); scale bar, 10 μm. One-way ANOVA with Tukey’s multiple comparison test. Representative images in fig. S10 (A and B). Further HER2 internalization analyses: Supplementary Results and fig. S11 (A to D). [(A), (B), and (D) to (F)] Data are arbitrary units (AU) normalized to control means ± SEM. [(A) to (F)] Statistical significance: * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.

    Journal: Science Advances

    Article Title: A trafficking regulatory subnetwork governs α V β 6 integrin-HER2 cross-talk to control breast cancer invasion and drug resistance

    doi: 10.1126/sciadv.adk9944

    Figure Lengend Snippet: ( A and B ) Affibody-chase experiments. Cells surface labeled with FITC-conjugated HER2 affibody and stimulated with soluble LAP (LAP) to stimulate α V β 6 integrin and trigger α V β 6 endocytosis, or vehicle (Control), 0- to 60-min time course. Quantitation represents cytoplasmic HER2 fluorescence intensity analysis in (A) trastuzumab-sensitive or (B) trastuzumab-resistant BT474 cells ( N = 3; 27 to 50 cells per condition), normalized to control trastuzumab-sensitive BT474 cells (0 min); scale bar, 10 μm. Two-way ANOVA with Šídák’s multiple comparison test. Image intensity increased in (B), relative to (A), due to low cell surface HER2 levels in trastuzumab-resistant cells to highlight internalization differences. ( C ) HER2 (green) and RAB5 (magenta) immunofluorescence in trastuzumab-sensitive and trastuzumab-resistant BT474 cells, treated with soluble LAP, 0 to 60 min ( N = 3; 16 to 28 cells per condition); scale bar, 10 μm. ( Ca ) HER2/RAB5 colocalization quantitation (Pearson’s coefficient ± SEM). Two-way ANOVA with Dunnett’s multiple comparison test. ( D ) Active RAB5 pull-down assays. 0- to 60-min LAP stimulation time course. Quantitation of mean RAB5 activity (pull-down eluate), relative to total RAB5 (lysate) ± SEM ( N = 3), normalized to 0-min trastuzumab-sensitive cells. One-way ANOVA with Dunnett’s multiple comparison test. ( E and F ) Affibody-chase experiments in (E) siControl Trastuzumab-Sensitive or (F) Trastuzumab-Resistant BT474 cells expressing constitutively active RAB5 (RAB5CA), dominant-negative RAB5 (RAB5DN), dominant-negative RAB7 (RAB7DN), or mCherry vector control. Cells were surface labeled with FITC-conjugated HER2 affibody and stimulated with soluble LAP (LAP), or vehicle control (control), for 0 or 30 min. Quantitation represents cytoplasmic HER2 fluorescence intensity ( N = 3; 81 to 87 cells per condition); scale bar, 10 μm. One-way ANOVA with Tukey’s multiple comparison test. Representative images in fig. S10 (A and B). Further HER2 internalization analyses: Supplementary Results and fig. S11 (A to D). [(A), (B), and (D) to (F)] Data are arbitrary units (AU) normalized to control means ± SEM. [(A) to (F)] Statistical significance: * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.

    Article Snippet: For protein expression, cells were transfected with DNA (1 μg/ml): constitutively active RAB5 ( ) [mcherry-RAB5CA(Q79L), Addgene plasmid #35138], dominant-negative RAB5 [mCherry-RAB5DN(S34N), Addgene plasmid #35139] , dominant-negative RAB7 [DsRed-RAB7 DN(T22N), Addgene plasmid #12662] , or empty pmCherry-C1 vector (Clontech, Addgene plasmid #3552).

    Techniques: Labeling, Control, Quantitation Assay, Fluorescence, Comparison, Immunofluorescence, Activity Assay, Expressing, Dominant Negative Mutation, Plasmid Preparation

    ( A ) Trastuzumab-Sensitive Cells: GDI2 is recruited to sites proximal to α V β 6 IACs and coordinates HER2 and α V β 6 trafficking and signaling by locally modulating RAB5 activity. GDI2-mediated cross-talk between α V β 6 and HER2 affects membrane availability of both receptors, ultimately influencing migration, invasion, and TGFβ activation. ( B ) Trastuzumab-Resistant Cells: GDI2 is excluded from α V β 6 IACs, leading to dysregulation of RAB5 activation dynamics, followed by increased RAB7 activation. Consequently, HER2/α V β 6 cross-talk is impaired, altering receptor trafficking dynamics and disrupting bioavailability of both HER2 and α V β 6 integrin at the plasma membrane. This dysregulation further affects TGFβ activation, resulting in increased cell invasiveness and metastatic potential. Overall, these changes may increase the ability of cells to evade HER2 targeting drugs.

    Journal: Science Advances

    Article Title: A trafficking regulatory subnetwork governs α V β 6 integrin-HER2 cross-talk to control breast cancer invasion and drug resistance

    doi: 10.1126/sciadv.adk9944

    Figure Lengend Snippet: ( A ) Trastuzumab-Sensitive Cells: GDI2 is recruited to sites proximal to α V β 6 IACs and coordinates HER2 and α V β 6 trafficking and signaling by locally modulating RAB5 activity. GDI2-mediated cross-talk between α V β 6 and HER2 affects membrane availability of both receptors, ultimately influencing migration, invasion, and TGFβ activation. ( B ) Trastuzumab-Resistant Cells: GDI2 is excluded from α V β 6 IACs, leading to dysregulation of RAB5 activation dynamics, followed by increased RAB7 activation. Consequently, HER2/α V β 6 cross-talk is impaired, altering receptor trafficking dynamics and disrupting bioavailability of both HER2 and α V β 6 integrin at the plasma membrane. This dysregulation further affects TGFβ activation, resulting in increased cell invasiveness and metastatic potential. Overall, these changes may increase the ability of cells to evade HER2 targeting drugs.

    Article Snippet: For protein expression, cells were transfected with DNA (1 μg/ml): constitutively active RAB5 ( ) [mcherry-RAB5CA(Q79L), Addgene plasmid #35138], dominant-negative RAB5 [mCherry-RAB5DN(S34N), Addgene plasmid #35139] , dominant-negative RAB7 [DsRed-RAB7 DN(T22N), Addgene plasmid #12662] , or empty pmCherry-C1 vector (Clontech, Addgene plasmid #3552).

    Techniques: Activity Assay, Membrane, Migration, Activation Assay, Clinical Proteomics

    ( A ) Differential gene expression data (RNA-seq) for the GDI2 / RAB5A / RAB7A / ERBB2 / ITGB6 cluster in normal breast tissue ( n = 403; light gray) and breast invasive carcinoma ( n = 1097; dark gray). Data were extracted from the TNMplot database ( tnmplot.com ). Black lines in violin blots represent the median. Mann-Whitney test. ( B ) Volcano plot showing statistical analysis (ANOVA) of RNA-seq gene expression data of patients with HER2+ breast cancer from the METABRIC cohort expressing high (Right) and low (Left) levels of ITGB6 (Q1 versus Q4). Significant genes (dark gray); nonsignificant genes (light gray); relevant genes are highlighted in purple. ( C ) Visual representation of GO terms analysis (ClueGO, cellular compartment) of genes highly and significantly expressed in tumors expressing high levels of ITGB6 (Q4). Colors represent specific merged GO term groups, node size represents the level of significance of each GO term, and clustering and edge length represent functionally grouped networks based on kappa score. ( D ) OS of patients with HER2+ breast cancer and with high (above median) expression of ITGB6 , expressing high (red) or low (black) levels of GDI2 , ERBB2 , RAB5A , and RAB7A . ( E and F ) Differential ITGB6 gene expression (gene chip) in patients with HER2+ breast cancer subdivided according to therapeutic response to trastuzumab. (E) Initial pathological complete response (responder) versus residual disease after completing therapy (nonresponder) ( n = 77 patients). (F) RFS at 5 years (responder) versus samples relapsed before 5 years (nonresponder) ( n = 24 patients). Two-sided Student’s t test. [(A), (E), and (F)] Statistical significance: * P < 0.05; **** P < 0.0001.

    Journal: Science Advances

    Article Title: A trafficking regulatory subnetwork governs α V β 6 integrin-HER2 cross-talk to control breast cancer invasion and drug resistance

    doi: 10.1126/sciadv.adk9944

    Figure Lengend Snippet: ( A ) Differential gene expression data (RNA-seq) for the GDI2 / RAB5A / RAB7A / ERBB2 / ITGB6 cluster in normal breast tissue ( n = 403; light gray) and breast invasive carcinoma ( n = 1097; dark gray). Data were extracted from the TNMplot database ( tnmplot.com ). Black lines in violin blots represent the median. Mann-Whitney test. ( B ) Volcano plot showing statistical analysis (ANOVA) of RNA-seq gene expression data of patients with HER2+ breast cancer from the METABRIC cohort expressing high (Right) and low (Left) levels of ITGB6 (Q1 versus Q4). Significant genes (dark gray); nonsignificant genes (light gray); relevant genes are highlighted in purple. ( C ) Visual representation of GO terms analysis (ClueGO, cellular compartment) of genes highly and significantly expressed in tumors expressing high levels of ITGB6 (Q4). Colors represent specific merged GO term groups, node size represents the level of significance of each GO term, and clustering and edge length represent functionally grouped networks based on kappa score. ( D ) OS of patients with HER2+ breast cancer and with high (above median) expression of ITGB6 , expressing high (red) or low (black) levels of GDI2 , ERBB2 , RAB5A , and RAB7A . ( E and F ) Differential ITGB6 gene expression (gene chip) in patients with HER2+ breast cancer subdivided according to therapeutic response to trastuzumab. (E) Initial pathological complete response (responder) versus residual disease after completing therapy (nonresponder) ( n = 77 patients). (F) RFS at 5 years (responder) versus samples relapsed before 5 years (nonresponder) ( n = 24 patients). Two-sided Student’s t test. [(A), (E), and (F)] Statistical significance: * P < 0.05; **** P < 0.0001.

    Article Snippet: For protein expression, cells were transfected with DNA (1 μg/ml): constitutively active RAB5 ( ) [mcherry-RAB5CA(Q79L), Addgene plasmid #35138], dominant-negative RAB5 [mCherry-RAB5DN(S34N), Addgene plasmid #35139] , dominant-negative RAB7 [DsRed-RAB7 DN(T22N), Addgene plasmid #12662] , or empty pmCherry-C1 vector (Clontech, Addgene plasmid #3552).

    Techniques: Gene Expression, RNA Sequencing, MANN-WHITNEY, Expressing, Clinical Proteomics

    ( A ) HeLa cells transfected with GFP–RIG-I and TAPE-RFP were mock-treated or transfected with 5′-triphosphate RNA (5′ppp RNA; 1 μg/ml) for 4 hours. These cells were subjected to confocal microscopic analyses. Arrows indicated the merged speckles. ( B ) Similar to (A), FITC-labeled polyI:C (1 μg/ml) was transfected into HeLa cells expressing RIG-I–CFP and TAPE-RFP for 1.5 hours. The outlined area is enlarged to show merged speckles (right). ( C ) Confocal images of HeLa cells transfected with GFP–RIG-I and Rab5-RFP before and after polyI:C transfection for the indicated times (left). The outlined regions are magnified (middle). The fluorescent intensity of the white lines was measured in the areas (right). ( D ) Confocal images of HeLa cells transfected with GFP–RIG-I and Rab7-RFP before and after polyI:C transfection for the indicated times (left). The outlined regions are magnified (right). ( E ) Confocal images of HeLa cells transfected with GFP–RIG-I and FLAG-MAVS before and after polyI:C transfection for the indicated times (left). FLAG-MAVS was immunostained by the anti-FLAG antibody. ( F ) HEK293T cells were transfected with Flag–RIG-I alone or with RFP-Rab5 and then left untreated or treated with IAV RNA transfection for 3 hours. The IP-WB analysis examined RIG-I interaction with Rab5. ( G ) Confocal images of HeLa cells transfected with TAPE-CFP, GFP–RIG-I, and RFP-Rab5 before and after 5′ppp RNA (1 μg/ml) stimulation. Arrows denote speckles formed by TAPE-CFP, GFP–RIG-I, and RFP-Rab5. Scale bars, (A to E and G) 10 μm.

    Journal: Science Advances

    Article Title: Endosomes serve as signaling platforms for RIG-I ubiquitination and activation

    doi: 10.1126/sciadv.adq0660

    Figure Lengend Snippet: ( A ) HeLa cells transfected with GFP–RIG-I and TAPE-RFP were mock-treated or transfected with 5′-triphosphate RNA (5′ppp RNA; 1 μg/ml) for 4 hours. These cells were subjected to confocal microscopic analyses. Arrows indicated the merged speckles. ( B ) Similar to (A), FITC-labeled polyI:C (1 μg/ml) was transfected into HeLa cells expressing RIG-I–CFP and TAPE-RFP for 1.5 hours. The outlined area is enlarged to show merged speckles (right). ( C ) Confocal images of HeLa cells transfected with GFP–RIG-I and Rab5-RFP before and after polyI:C transfection for the indicated times (left). The outlined regions are magnified (middle). The fluorescent intensity of the white lines was measured in the areas (right). ( D ) Confocal images of HeLa cells transfected with GFP–RIG-I and Rab7-RFP before and after polyI:C transfection for the indicated times (left). The outlined regions are magnified (right). ( E ) Confocal images of HeLa cells transfected with GFP–RIG-I and FLAG-MAVS before and after polyI:C transfection for the indicated times (left). FLAG-MAVS was immunostained by the anti-FLAG antibody. ( F ) HEK293T cells were transfected with Flag–RIG-I alone or with RFP-Rab5 and then left untreated or treated with IAV RNA transfection for 3 hours. The IP-WB analysis examined RIG-I interaction with Rab5. ( G ) Confocal images of HeLa cells transfected with TAPE-CFP, GFP–RIG-I, and RFP-Rab5 before and after 5′ppp RNA (1 μg/ml) stimulation. Arrows denote speckles formed by TAPE-CFP, GFP–RIG-I, and RFP-Rab5. Scale bars, (A to E and G) 10 μm.

    Article Snippet: Zhang; and DsRed-rab5 DN (Addgene, plasmid #13051) and DsRed-rab7 DN (Addgene, plasmid #12662) by R. Pagano.

    Techniques: Transfection, Labeling, Expressing